Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL

نویسندگان

  • Fangxing Xiao
  • Xiaobin Yao
  • Qianhong Bao
  • Danzhen Li
  • Yi Zheng
چکیده

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Interaction of Cisplatin with Cellular Macromolecules: A Fourier Transform Infrared Spectroscopy Study

Platinum is a metallic element, which may react with our cellular component through its involvement in cancer chemotherapy medications. Cisplatin is one of the most useful antineoplastic drugs against human ovarian carcinoma, which has the central element of platinum in its structure. The nature of chemical interaction between platinum and cellular macromolecules is yet to be understood. We exa...

متن کامل

Interaction of Cisplatin with Cellular Macromolecules: A Fourier Transform Infrared Spectroscopy Study

Platinum is a metallic element, which may react with our cellular component through its involvement in cancer chemotherapy medications. Cisplatin is one of the most useful antineoplastic drugs against human ovarian carcinoma, which has the central element of platinum in its structure. The nature of chemical interaction between platinum and cellular macromolecules is yet to be understood. We exa...

متن کامل

FTIR Biospectroscopy Investigation on Cisplatin Cytotoxicity in Three Pairs of Sensitive and Resistant Cell Line

Fourier Transformed Infrared Spectroscopy (FTIR) has extensively been used for biological applications. Cisplatin is one the most useful antineoplastic chemotherapy drugs for a variety of different human cancers. One of the clinical problems in its application, which would consequently affect the therapeutic outcome of its application, is the occurrence of resistance to this agent. In this proj...

متن کامل

New Activated Carbon from Persian Mesquite Grain as an Excellent Adsorbent

This paper presents a systematic study of the surface chemistry, porous texture and adsorptive characteristics of prepared new activated carbon using Persian mesquite grain. Several techniques and methodologies such as, proximate analysis, N2 adsorption–desorption isotherms, scanning electron microscope (SEM), Fourier transform infrared spectroscopy(FT-IR), X-ray Diffraction (XRD), X-ray photoe...

متن کامل

Preparation of Fe Substituted ZnO Nanoparticles and Investigation of Their Magnetic Behaviors

Nano-powders of diluted magnetic semiconductor Zn1-xFexO (0.0≤ x ≤0.1) were prepared via the sol-gel auto-combustion method. Crystal structure and phase identification carried out by X-Ray Diffraction (XRD) analysis. Mean crystallite size of the powders was estimated by Scherrer's formula. As M-H loops of the Fe substituted ZnO showed ferromagnetic behavior. The result...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 2012  شماره 

صفحات  -

تاریخ انتشار 2012